Bulletin of Botanical Research ›› 2022, Vol. 42 ›› Issue (6): 1014-1022.doi: 10.7525/j.issn.1673-5102.2022.06.011
• Molecular biology • Previous Articles Next Articles
Received:2022-04-08
Online:2022-11-20
Published:2022-11-22
Contact:
Guisheng LI
E-mail:gui-sheng@jsu.edu.cn
About author:SUN Jun(1996—),female,candidate master,mainly engaged in research on leaf development of Ceratopteris
Supported by:CLC Number:
Jun SUN, Guisheng LI. Sequencing and Analysis of miRNAs in Vegetative and Reproductive Growths of Ceratopteris pteridoides[J]. Bulletin of Botanical Research, 2022, 42(6): 1014-1022.
Add to citation manager EndNote|Ris|BibTeX
URL: https://bbr.nefu.edu.cn/EN/10.7525/j.issn.1673-5102.2022.06.011
Table 1
Conserved miRNAs identified in the two samples
名称 Name | 序列 Sequence(5′→3′) | log2比值 log2 ratioa | Q值 Q-value | 第一匹配 1st hit nameb | 覆盖度 Coverage /% | 第二匹配 2nd hit name | 覆盖度 Coverage /% |
|---|---|---|---|---|---|---|---|
| *miR408 | UGCACUGCCUCUUCCCUGGCUA | -10.23 | 1.52E-117 | ppt-miR408b | 95 | smo-miR408 | 95 |
| miR845b | UGCUCUGAUACCAAGUGUGAG | -5.57 | 1.24E-09 | bdi-miR845 | 86 | ath-miR845a | 76 |
| miR6173 | AGCCGUAAACGAUGGAUA | -1.54 | 1.03E-17 | hbr-miR6173 | 90 | n.a.c | n.a. |
| miR5368 | AGAGACAGUCCCAGGUAGACA | -1.30 | 4.04E-52 | gma-miR5368 | 95 | n.a. | n.a. |
| *miR529d | AGAAGAGAGAGAGCGCAGCCC | -1.08 | 0 | ppt-miR529d | 95 | pab-miR529e | 90 |
| *miR535d | UGACGACGAGAGAGAGCACGC | -0.95 | 0 | ppt-miR535c | 100 | pab-miR535a | 100 |
| *miR156a-5p | UGACAGAAGAGAGUGAGCAC | -0.84 | 0 | ppt-miR156c | 100 | smo-miR156a | 95 |
| miR169a-5p | CAGCCAAGGAUGACUUGCCGA | -0.09 | 4.09E-04 | pde-miR169 | 90 | ath-miR169a-5p | 100 |
| miR5245 | ACAUCAUAGAACACAGGCAG | -0.01 | 2.93E-02 | mtr-miR5245 | 90 | n.a. | n.a. |
| *miR390a-5p | AAGCUCAGGAGGGAUAGCGCC | 0.25 | 8.23E-288 | ppt-miR390a | 100 | pta-miR390 | 100 |
| *miR894 | GUUUCACGUCGGGUUCACCA | 0.30 | 0 | ppt-miR894 | 95 | nat-miR894 | 95 |
| miR8155 | GUAACCUGGCUCUGAUACCA | 0.47 | 1.61E-28 | aof-miR8155 | 100 | cpa-miR8155 | 100 |
| *miR157d | UGACAGAAGAUAGAGAGCAC | 0.56 | 0 | ppt-miR156b | 100 | smo-miR156b | 95 |
| miR5139 | AACCUGGCUCUGAUACCA | 0.57 | 4.00E-57 | aof-miR5139b | 86 | cas-miR5139 | 95 |
| *miR166a-3p | UCGGACCAGGCUUCAUUCCCC | 0.60 | 0 | ppt-miR166a | 95 | smo-miR166b | 95 |
| miR5182 | UGACAUCUUGGAACACGUGCG | 0.60 | 1.73E-06 | bdi-miR5182 | 76 | n.a. | n.a. |
| *miR166m | UCGGACCAGGCUUCAUUCCCU | 0.65 | 0 | ppt-miR166a | 95 | smo-miR166b | 95 |
| *miR165a-3p | UCGGACCAGGCUUCATCCCCU | 0.83 | 1.05E-21 | ppt-miR166a | 90 | smo-miR166b | 90 |
| miR168a-5p | UCGCUUGGUGCAGGUCGGGAA | 0.85 | 0 | pab-miR168a | 100 | ath-miR168b-5p | 100 |
| miR396c | UCAAGAAAGCUGUGGGAAAAC | 0.85 | 0 | pab-miR396e | 90 | ath-miR396b-3p | 86 |
| miR396g-3p | CUCAAGAAAGCUGUGGGAAAA | 0.86 | 0 | pab-miR396e | 95 | ath-miR396b-3p | 90 |
| miR8175 | CGUUCCCCGGCAACGGCGCCA | 1.03 | 2.86E-194 | ath-miR8175 | 95 | n.a. | n.a. |
| *miR1026a | UGAGAAAUACUUGAGAGGACA | 1.05 | 4.59E-04 | ppt-miR1026b | 95 | n.a. | n.a. |
| miR5655 | AAGUAGACACACAAGAAAGAG | 1.06 | 2.11E-06 | ath-miR5655 | 90 | n.a. | n.a. |
| miR5236a | AAGUUUCGGGCAGAUUUGGUA | 1.07 | 1.00E-06 | mtr-miR5236d | 81 | n.a. | n.a. |
| miR167a-5p | UGAAGCUGCCAGCAUGAUCUA | 1.10 | 2.11E-10 | pab-miR167b | 91 | ath-miR167a-5p | 100 |
| miR950-5p | UCACGUCAGGGCCACGAUGGUU | 1.17 | 1.33E-06 | pab-miR950b | 100 | n.a. | n.a. |
| miR1312 | UUCGGAGAGAAAAUGGCGACAU | 1.28 | 9.31E-04 | pab-miR1312a | 100 | pde-miR1312 | 95 |
| miR8752 | UGGGGAUAGGUAUCUGCA | 1.47 | 2.73E-05 | gra-miR8752 | 81 | n.a. | n.a. |
| *miR160h | UGCCUGGCUCCCUGCAUGCCA | 1.63 | 3.88E-92 | ppt-miR160c | 95 | smo-miR160b | 100 |
| miR1314 | UCGGCCUCGAAUGUUAGGAGAA | 1.74 | 1.07E-05 | pab-miR1314 | 100 | pde-miR1314 | 95 |
| miR172d | CGAGAAUCUUGAUGAUGCUGC | 2.03 | 0 | ath-miR172c | 90 | osa-miR172d-3p | 90 |
| miR5041-3p | AUGUUGAGCAAUUUGAAGAUGAA | 2.05 | 3.53E-06 | gma-miR5041-3p | 95 | n.a. | n.a. |
| *miR319b | AGCUGCCGCGUCAUGCAUCCA | 3.05 | 0 | ppe-miR319b | 95 | smo-miR319 | 90 |
| miR159c-5p | GAGCUCCCAUCGGUCCAAUC | 3.62 | 0 | zma-miR159d-5p | 90 | bdi-miR159a-5p | 95 |
| *miR1083 | UAGCCUGGAACGAAGCACGGG | 4.00 | 0 | smo-miR1083 | 95 | pab-miR1083 | 90 |
| miR397 | UAUUGAGUGCAGCGUUGACGG | 5.22 | 1.82E-06 | pab-miR397i | 100 | ath-miR397a | 86 |
| miR3630-3p | GGGAAUCUCUCUGAUGCAC | 5.52 | 2.24E-07 | vvi-miR3630-3p | 86 | han-miR3630-3p | 77 |
| miR4414a-5p | AGCUGCUGACUCGUUGGCUCA | 6.91 | 1.80E-14 | gma-miR4414a-5p | 100 | mtr-miR4414a-5p | 100 |
| miR394a | ACUGGCAUUCUGUCCACCUUC | 9.42 | 2.66E-54 | pab-miR394a | 85 | ath-miR394a | 85 |
| miR7806 | UGAAGAUGACCGCAUGAGCA | 12.30 | 3.48E-241 | rgl-miR7806 | 90 | n.a. | n.a. |
| miR171a-5p | CGAUAUUGUAGCGGUUCAAUC | 12.89 | 0 | ath-miR171c-5p | 95 | osa-miR171c-5p | 95 |
Table 2
Differential expression of target genes of known miRNAs
| miRNA | 靶基因 Target gene | 结合位点 Binding site(5′→3′) | log2比值 log2 ratio* | FDR |
|---|---|---|---|---|
| miR408 | CL11590.Contig2_All | CUGUCAGGAAGAGGCAGUGCG | 0.95 | 6.06E-05 |
| CL1188.Contig1_All | UAAGCAGGGAAGAGGCAGUGCU | 1.45 | 2.87E-18 | |
| CL1513.Contig2_All | UAAGCAGGGAAGAGGCAGUGCU | 2.32 | 3.87E-12 | |
| CL3116.Contig6_All | GGGUUGGGGAAGAGGCAGUGCA | 1.86 | 3.46E-02 | |
| Unigene13203_All | UCGCAAGGGAAGAGGCAGUGCA | 2.67 | 0 | |
| miR156a-5p | CL3137.Contig2_All | GUGCUCUCUCUCUUCAGUCA | 1.47 | 2.44E-70 |
| Unigene24729_All | GUGCUCUCUCUCUUCAGUCA | 1.37 | 3.64E-56 | |
| CL7715.Contig3_All | GUGCUCUCUCUCUUCUGUCA | 1.31 | 1.26E-28 | |
| CL5455.Contig2_All | GUGCUCUCUCUCUUCUGUCA | 1.22 | 2.29E-26 | |
| miR169a-5p | CL881.Contig4_All | UCAGGCAAUUCAUUCUUGGCUU | 2.71 | 1.22E-04 |
| CL881.Contig2_All | UAGGCAAUUCAUUCUUGGCUU | 0.93 | 3.89E-14 | |
| miR394a | Unigene29847_All | GAGAGGUGGACAGAAUGCCACA | -2.04 | 0 |
| miR172d | CL465.Contig1_All | GCAGCAUCAUCAGGAUUCUCA | 0.27 | 1.08E-06 |
| CL295.Contig3_All | GCAGCAUCAUCAGGAUUCUCA | -0.05 | 9.60E-01 | |
| Unigene21783_All | GCAGCAUCAUCAGGAUUCUCA | -1.92 | 1.02E-26 | |
| miR845b | CL12834.Contig4_All | UUCACAGUGGUAUCAGAGCA | -1.29 | 4.94E-09 |
| CL138.Contig3_All | UUCUUACAUGGUAUCAGAGCU | -0.46 | 3.74E-03 | |
| CL3488.Contig4_All | UUCACAGUGGUAUCAGAGCA | -0.91 | 1.35E-04 | |
| miR171a-5p | Unigene13102_All | GAUUGAGCCGCGCCAAUAUCG | 0.19 | 6.26E-22 |
| miR166 | CL784.Contig5_All | CUGGAAUGAAGCCUGGUCCUGA | 1.35 | 3.50E-04 |
| Unigene9392_All | CUGGGAUGAAGCCUGGUCCGG | 1.48 | 1.16E-20 | |
| CL1122.Contig2_All | CUGGAAUGAAGCCUGGUCCUGA | 0.33 | 5.70E-01 | |
| CL1909.Contig6_All | CUGGAAUGAAGCCUGGUCCGG | 1.30 | 2.24E-02 | |
| CL575.Contig12_All | CUGGGAUGAAGCCUGGUCCGG | 1.20 | 3.95E-13 | |
| miR160h | Unigene18882_All | AGGCAUGCAGGGAGCCAGGCA | 0.71 | 1.19E-41 |
| Unigene9932_All | AGGCAUGCAGGGAGCCAGGCA | -0.03 | 6.41E-01 | |
| CL2591.Contig2_All | AGGCAUGCAGGGAGCCAGGCA | 0.83 | 1.90E-01 | |
| miR159c-5p | CL8045.Contig1_All | GAUUGGACUGAAGGGAGCUC | 1.26 | 5.10E-03 |
| Unigene36353_All | AAUUGGACUGAAGGGAGCUC | 7.14 | 1.79E-40 | |
| miR319b | CL12713.Contig3_All | GGCAGCUCCCUUCAGUCCAA | 0.84 | 3.26E-01 |
| CL8045.Contig1_All | UAGAGCUCCCUUCAGUCCAA | 1.26 | 5.10E-03 | |
| Unigene36353_All | UCGAGCUCCCUUCAGUCCAA | 7.14 | 1.79E-40 | |
| miR397 | CL6968.Contig1_All | AUAACUCAAGACGCAACUGUC | 1.48 | 4.60E-12 |
Fig.2
Characterization of tasiR-ARFA.MIR390 sequences with sites of miR390 and miR390*;B.TAS3 sequences with corresponding sRNAs;Cp.Ceratopteris pteridoides;Cg.Cyrtomium guizhouense;Pn.Parathelypteris nipponica;sRNAs in phase with the 5′ cleavage site of miR390 were indicated by forward arrows and those with the 3′ cleavage site by backward arrows;One sRNA corresponding to tasiR-ARF was indicated by a filled red arrow in CpTAS3b,and a putative sRNA corresponding tasiR-ARF was shown by a punctuated red arrow in CpTAS3a
| 1 | RHOADES M W, REINHART B J, LIM L P,et al.Prediction of plant microRNA targets[J].Cell,2002,110(4): 513-520. |
| 2 | SCHWAB R, PALATNIK J F, RIESTER M,et al.Specific effects of microRNAs on the plant transcriptome[J].Developmental Cell,2005,8(4):517-527. |
| 3 | XU M L, HU T Q, ZHAO J F,et al.Developmental functions of miR156-regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE(SPL) genes in Arabidopsis thaliana [J].PLoS Genetics,2016,12(8):e1006263. |
| 4 | WU G, PARK M Y, CONWAY S R,et al.The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis [J].Cell,2009,138(4):750-759. |
| 5 | WU G, POETHIG R S.Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3 [J].Development,2006,133(18):3539-3547. |
| 6 | SCHMID M, UHLENHAUT N H, GODARD F,et al.Dissection of floral induction pathways using global expression analysis[J].Development,2003,130(24):6001-6012. |
| 7 | CHUCK G, CIGAN A M, SAETEURN K,et al.The heterochronic maize mutant Corngrass1 results from overexpression of a tandem microRNA[J].Nature Genetics,2007,39(4):544-549. |
| 8 | CARDON G H, HÖHMANN S, NETTESHEIM K,et al.Functional analysis of the Arabidopsis thaliana SBP-box gene SPL3:a novel gene involved in the floral transition[J].The Plant Journal,1997,12(2):367-377. |
| 9 | WANG J W, CZECH B, WEIGEL D.miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana [J].Cell,2009,138(4):738-749. |
| 10 | YANG L, XU M L,KOO Y,et al.Sugar promotes vegetative phase change in Arabidopsis thaliana by repressing the expression of MIR156A and MIR156C [J].elife,2013,2:e00260. |
| 11 | AUKERMAN M J, SAKAI H.Regulation of flowering time and floral organ identity by a microRNA and its APETALA2-like target genes[J].The Plant Cell,2003,15(11):2730-2741. |
| 12 | CHEN X M.A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development[J].Science,2004,303(5666):2022-2025. |
| 13 | Ó'MAOILÉIDIGH D S, DVAN DRIEL A, SINGH A,et al.Systematic analyses of the MIR172 family members of Arabidopsis define their distinct roles in regulation of APETALA2 during floral transition[J].PLoS Biology,2021,19(2):e3001043. |
| 14 | LIAN H, WANG L, MA N,et al.Redundant and specific roles of individual MIR172 genes in plant development[J].PLoS Biology,2021,19(2):e3001044. |
| 15 | LAUTER N, KAMPANI A, CARLSON S,et al.microRNA172 down-regulates glossy15 to promote vegetative phase change in maize[J].Proceedings of the National Academy of Sciences of the United States of America,2005,102(26):9412-9417. |
| 16 | EVANS M M, PASSAS H J, POETHIG R S.Heterochronic effects of glossy15 mutations on epidermal cell identity in maize[J].Development,1994,120(7):1971-1981. |
| 17 | MOOSE S P, SISCO P H.Glossy15 controls the epidermal juvenile-to-adult phase transition in maize[J].The Plant Cell,1994,6(10):1343-1355. |
| 18 | HYUN Y, RICHTER R, VINCENT C,et al.Multi-layered regulation of SPL15 and cooperation with SOC1 integrate endogenous flowering pathways at the Arabidopsis shoot meristem[J].Developmental Cell,2016,37(3):254-266. |
| 19 | PRYER K M, SCHUETTPELZ E, WOLF P G,et al.Phylogeny and evolution of ferns (monilophytes) with a focus on the early leptosporangiate divergences[J].American Journal of Botany,2004,91(10):1582-1598. |
| 20 | CHRISTENHUSZ M J M, CHASE M W.Trends and concepts in fern classification[J].Annals of Botany,2014,113(4):571-594. |
| 21 | SHEN H, JIN D M, SHU J P,et al.Large-scale phylogenomic analysis resolves a backbone phylogeny in ferns[J].GigaScience,2018,7(2):1-11. |
| 22 | CONWAY S J, DI STILIO V S.An ontogenetic framework for functional studies in the model fern Ceratopteris richardii [J].Developmental Biology,2020,457(1):20-29. |
| 23 | JORDON-THADEN I E, CHANDERBALI A S, GITZENDANNER M A,et al.Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta[J].Applications in Plant Sciences,2015,3(5):1400105. |
| 24 | HAFNER M, LANDGRAF P, LUDWIG J,et al.Identification of microRNAs and other small regulatory RNAs using cDNA library sequencing[J].Methods,2008,44(1):3-12. |
| 25 | KANG W J, FRIEDLÄNDER M R.Computational prediction of miRNA genes from small RNA sequencing data[J].Frontiers in Bioengineering and Biotechnology,2015,3:7. |
| 26 | MA X X, TANG Z H, QIN J P,et al.The use of high-throughput sequencing methods for plant microRNA research[J].RNA Biology,2015,12(7):709-719. |
| 27 | WU L, ZHOU H Y, ZHANG Q Q,et al.DNA methylation mediated by a microRNA pathway[J].Molecular Cell,2010,38(3):465-475. |
| 28 | FLOYD S K, BOWMAN J L.Distinct developmental mechanisms reflect the independent origins of leaves in vascular plants[J].Current Biology,2006,16(19):1911-1917. |
| 29 | SUN J, LI G S.Leaf dorsoventrality candidate gene CpARF4 has conserved expression pattern but divergent tasiR-ARF regulation in the water fern Ceratopteris pteridoides [J].American Journal of Botany,2020,107(11):1470-1480. |
| 30 | LIU J, LIU X N, ZHANG S J,et al.TarDB:an online database for plant miRNA targets and miRNA-triggered phased siRNAs[J].BMC Genomics,2021,22(1):348. |
| 31 | GUO Z L, KUANG Z, WANG Y,et al.PmiREN:a comprehensive encyclopedia of plant miRNAs[J].Nucleic Acids Research,2020,48(D1):D1114-D1121. |
| 32 | YOU C J, CUI J, WANG H,et al.Conservation and divergence of small RNA pathways and microRNAs in land plants[J].Genome Biology,2017,18(1):158. |
| 33 | BERRUEZO F, DE SOUZA F S J, PICCA P I,et al.Sequencing of small RNAs of the fern Pleopeltis minima (Polypodiaceae) offers insight into the evolution of the microrna repertoire in land plants[J].PLoS One,2017,12(5):e0177573. |
| 34 | CHO S H, CORUH C, AXTELL M J.miR156 and miR390 regulate tasiRNA accumulation and developmental timing in Physcomitrella patens [J].The Plant Cell,2012,24(12):4837-4849. |
| 35 | TSUZUKI M, NISHIHAMA R, ISHIZAKI K,et al.Profiling and characterization of small RNAs in the liverwort,Marchantia polymorpha,belonging to the first diverged land plants[J].Plant and Cell Physiology,2015,57(2):359-372. |
| 36 | AXTELL M J, BARTEL D P.Antiquity of microRNAs and their targets in land plants[J].The Plant Cell,2005,17(6):1658-1673. |
| 37 | ZUMAJO-CARDONA C, PABÓN-MORA N, AMBROSE B A.The evolution of euAPETALA2 genes in vascular plants:from plesiomorphic roles in sporangia to acquired functions in ovules and fruits[J].Molecular Biology and Evolution,2021,38(6):2319-2336. |
| 38 | GUO C K, XU Y M, SHI M,et al.Repression of miR156 by miR159 regulates the timing of the juvenile-to-adult transition in Arabidopsis [J].The Plant Cell,2017,29(6):1293-1304. |
| 39 | XUE X Y, ZHAO B, CHAO L M,et al.Interaction between two timing microRNAs controls trichome distribution in Arabidopsis [J].PLoS Genetics,2014,10(4):e1004266. |
| 40 | NATARAJAN B, BANERJEE A K.MicroRNA160 regulates leaf curvature in potato (Solanum tuberosum L.cv.Désirée)[J].Plant Signaling & Behavior,2020,15(5):1744373. |
| 41 | MALLORY A C, BARTEL D P, BARTEL B.MicroRNA - directed regulation of Arabidopsis AUXIN RESPONSE FACTOR17 is essential for proper development and modulates expression of early auxin response genes[J].The Plant Cell,2005,17(5):1360-1375. |
| 42 | REN W Q, WANG H, BAI J J,et al.Association of microRNAs with types of leaf curvature in Brassica rapa [J].Frontiers in Plant Science,2018,9:73. |
| 43 | SONG J B, HUANG S Q, DALMAY T,et al.Regulation of leaf morphology by microRNA394 and its target LEAF CURLING RESPONSIVENESS [J].Plant and Cell Physiology,2012,53(7):1283-1294. |
| 44 | ZHANG J P, YU Y, FENG Y Z,et al.MiR408 regulates grain yield and photosynthesis via a phytocyanin protein[J].Plant Physiology,2017,175(3):1175-1185. |
| 45 | LI W X, OONO Y, ZHU J H,et al.The Arabidopsis NFYA5 transcription factor is regulated transcriptionally and posttranscriptionally to promote drought resistance[J].The Plant Cell,2008,20(8):2238-2251. |
| 46 | ZHAO M, DING H, ZHU J K,et al.Involvement of miR169 in the nitrogen-starvation responses in Arabidopsis [J].New Phytologist,2011,190(4):906-915. |
| 47 | BORGES F, PARENT J S, VAN EX F,et al.Transposon-derived small RNAs triggered by miR845 mediate genome dosage response in Arabidopsis [J].Nature Genetics,2018,50(2):186-192. |
| 48 | HUANG S L, ZHOU J J, GAO L,et al.Plant miR397 and its functions[J].Functional Plant Biology,2021,48(4):361-370. |
| [1] | Yamei LIU, Yupeng WU, Limei LI, Min SU, Zhu YU, Lejun OUYANG. Differential Expression of miRNA396 and CKX Genes in Eucalyptus urophylla × E. grandis Callus Induced by Different Concentrations of Novel Mitogen PBU [J]. Bulletin of Botanical Research, 2022, 42(5): 840-847. |
| [2] | ZHOU Min, JIANG Dan, LIU Yue-Xiu, WANG Xiao-Rong, TANG Hao-Ru, CHEN Qing. amiRNA-mediated PL Gene Silencing Driven by the Fruit-specific Promoter P119 in Strawberry and Its Effect on Fruit Firmness [J]. Bulletin of Botanical Research, 2019, 39(3): 441-449. |
| [3] | XIONG Xue-Mei;WU Ying;*;WANG Yang. Research Progresses in the Regulation of miRNAs Biogenesis and Function in Plants [J]. Bulletin of Botanical Research, 2014, 34(2): 282-288. |
| [4] | YANG Hui-Qin;JIANG Jing;LIU Ming-Ying;QIAO Gui-Rong;JIANG Yan-Cheng;ZHUO Ren-Ying*. Construction of Expression Vector of ptc-miR801 Gene and Function Analysis [J]. Bulletin of Botanical Research, 2013, 33(5): 599-604. |
| [5] | ZHAI Jun-Miao;LUAN Yu-Shi*;CUI Juan-Juan. Evolution and Function Analysis of miR396 Gene Family [J]. Bulletin of Botanical Research, 2013, 33(4): 421-428. |
| [6] | BAO Qian;XU Tao;ZHANG Fu-Chun*. Cloning of miR417 Gene from Halostachys caspica and Its Effects on the Rates of Seed Germination and Seedling Survival [J]. Bulletin of Botanical Research, 2011, 31(4): 408-413. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||
